Skip to main content

Table 1 Oligonucleotide primers used in the study

From: Human parainfluenza virus type 2 hemagglutinin-neuramindase gene: sequence and phylogenetic analysis of the Saudi strain Riyadh 105/2009

PCR reaction / Primer (Polarity) Sequence (5′to 3′) Positiona PCR product
Primary    508 bp
HPIV2-cDNA (+) AACAATCTGCTGCAGCATTT 7437-7456
HPIV2-rev (−) ATGTCAGACAATGGGCAAAT 7925-7944
Nested    204 bp
HPIV2-nF(+) CCATTTACCTAAGTGATGGAAT 7479-7500
HPIV2-nR(−) GCCCTGTTGTATTTGGAAGAGA 7661-7682
Sequencing    
HPIV2-HN-F1(+) CGAACCCTTAAGGTGTCGTAACGTC 6648-6672 886 bp
HPIV2-HN-R1 (−) GGTATAGCAGTGACTGAACAGC 7512-7533  
HPIV2-HN-F2(+) GACCCATTGGTGTTACACTCACAATG 7348-7373 840 bp
HPIV2-HN-R2(−) GTTGCATTGCATGGCATGACTC 8166-8187  
HPIV2-HN-F3(+) GGTACCGTCCTATCAAGTTCC 8137-8157 426 bp
HPIV2-HN-R3 (−) GAATCTGGAGTCTTCATTCAATAG 8539-8562  
  1. a Nucleotide positions based on the complete genome sequence of HPIV-2 strain Greer; GenBank accession number AF533012.