Skip to main content

Table 1 Oligonucleotides used for plasmid construction

From: Changes in subcellular localization reveal interactions between human cytomegalovirus terminase subunits

Plasmid contains Oligonucleotide Sequence (5'-3')*
pMA319 UL51 MOL269 ATGTCCTGGGCTAAGCAGCG
MOL270 TTATTTACCCGGCGCCGACT
pMA48 UL56 (5’) MOL60 CCATGG AGATGAATTTGTTAC
MOL64 CTCCTCGAGAATATGCTTGAT
pMA49 UL56 (3’) MOL59 ACAGGTTAACGCAGACTACCA
MOL65 ATATTCTCGAGGAGATTCGAC
pUL89 UL89 cDNA MOL53 CTGCTGCGTGCCTAGCTGAC
MOL54 CATCATGTTGCGCGGAGACT
pMA323 FLAG-UL51 UL51-FLAG-H3F GACCTAAGCTT TCCTGGGCTAAGCAGCGGGTG
UL51-FLAG-ER1R TACGATGAATTC TTATTTACCCGGCGCCGACTC
pMA326 FLAG-UL51 UL51-FLAG-BamHI CGGGATCC ATGGACTACAAGGACGACGA
UL51-FLAG-ER1R TACGATGAATTC TTATTTACCCGGCGCCGACTC
pMA325 UL56 UL56-V5-F GAGATGAATTTGTTACAGAAACTA
UL56-V5-R TTAACGCAGACTACCAGGCAC
pMA324 MYC-UL89 linkA GATCCACCATGGAACAAAAACTCATCTCAGAAGAGGATCTGG
linkB AATTCCAGATCCTCTTCTGAGATGAGTTTTTGTTCCATGGTG
UL89-NMyc-ER1F CATGATGAATTC TTGCGCGGAGACTCGGCC
UL89-NMyc-XB1R TACATGTCTAGA CTAGCTGACCCTGAAACG
  1. *restriction sites used for cloning are underlined.