Skip to main content

Advertisement

Table 1 List of primers used

From: Mouse macrophage innate immune response to chikungunya virus infection

Gene Primer 1 (5′→ 3′) Primer 2 (5′→ 3′) Amplicon (bp)
GAPDH GAACGGGAAGCTTGTCATCA TGACCTTGCCCACAGCCTTG 473
IFNα4 AGCCTGTGTGATGCAGGAACC CAGCAAGTTGGTTGAGGAAGAG 171
ISG56 CTCAGAGCAGGTCCAGTTCC TCCATCTCAGCACACTCCAG 300
TNFα ACGGCATGGATCTCAAAGAC CGGACTCCGCAAAGTCTAAG 325
CHIKV_E1 AAGCTYCGCGTCCTTTACCAAG CCAAATTGTCCYGGTCTTCCT 209
Probe_E1 FAM – CCAATGTCYTCMGCCTGGACACCTTT - TAMRA   
CHIKV_E2 ACKCTGACRGTGGGATTYAC ACGTGCTGCAAGGTARCTCT 139
CHIKV_Pos ACGTGCTGCAAGGTARCTCT   
CHIKV_Neg ACKCTGACRGTGGGATTYAC