Skip to main content

Advertisement

Table 1 Sequences of primers

From: Over-expression of mitochondrial antiviral signaling protein inhibits coxsackievirus B3 infection by enhancing type-I interferons production

Primers       Sequence
IFN-α[39]
  F 5’- GGTGCTCAGCTGCAAGTCAA −3’
  R 5’- GCTACCCAGGCTGTGGGTT −3’
IFN-β
  F 5’- AAGGCCAAGGAGTACAGTC −3’
  R 5’- AGTTTCGGAGGTAACCTG −3’
GAPDH[40]
  F 5’- ATCACTGCCACCCAGAAGAC −3’
  R 5’- TTTCTAGACGGCAGGTCAGG −3’
CVB3
  F 5’-GCACACACCCTCAAACCAGA-3’
  R 5’-ATGAAACACGGACACCCAAAG-3’
MAVS
  F 5’-CTCCTCGCTGCGGGAAGGGT-3’
  R 5’-GGGACGGTCCGAGGTCCCTG-3’