Skip to main content

Table 1 Oligonucleotide primers designed for SPV amplification by conventional gel-based PCR and real-time PCR

From: Development of a SYBR green real-time PCR method for rapid detection of sheep pox virus

Primer Sequence (5-3) Length
   Primer (bp) Product (bp)
Nf GGGGGATATGATTTTACCTTA 21 235a
Nr ATATACCGTTTTTCATTTCGTTAG 24  
900f TTATATGTTATACCAATCGTTGGTC 25 900b
900r TAACATACCTGCTAAAAACCAT 22  
  1. a Length of product amplified by real-time PCR primer pair.
  2. b Length of product amplified by conventional PCR primer pair.