Skip to main content

Table 3 Polymerase chain reaction characteristics for Human papillomavirus 18

From: Human Papillomavirus (HPV) genotype 18 variants in patients with clinical manifestations of HPV related infections in Bilbao, Spain

  Primer sequence (5′ – 3′) Annealing Temp/Cycles Nucleotides amplified* Amplicon size
E6 F AGTAACCGAAAACGGTCGGGA 55°C/40 cycles 38-491 454 pb
E6 R GTTGTGAAATCGTCGTTTTTCA    
E7 F TGAAAAACGACGATTTCACAAC 55°C/40 cycles 470-931 462 pb
E7 R ACCTTCTGGATCAGCCATTG    
E4 F GTAAAGGAAGGGTACAACACG 57°C/35 cycles 3309-3792 484 pb
E4 R CTGTCCAATGCCAGGTGGA    
LCR 1 F TCGGTTGCCTTTGGCTTAT 55°C/40 cycles 7465-7775 311 pb
LCR 1 R AAGGGTAGACAGAATGTTGGACA 55°C/40 cycles 7718-163 303 pb
LCR 2 F GCTAATTGCATACTTGGCTTG    
LCR 2 R TCCGTGCACAGATCAGGTAG    
MY11 GCACAGGGTCATAACAATGG 55°C/40 cycles 6558-7012 455 pb
MY09 CGTCCAAGGGATATTGATC    
L1 seq ACAGTCTCCTGTACCTGGG    
  1. *Position numbering refers to the first nucleotide of the HPV 18 reference genome (accession number NC001357). F: forward primer, R: reverse primer.