Skip to main content

Table 1 Sequences of primers used for the PCRs

From: Characterization of sequence elements from Malvastrum yellow vein betasatellite regulating promoter activity and DNA replication

Primers Sequences (5'-3') Underlined restriction site Position on MYVB
Y47βp138-F GAATTCAAGCTTCTCCATCATATCTTTAAAGT EcoRI, HindIII 690-671
Y47βp214-F GAATTCAAGCTTCTCATGTGTACGTATATATACG EcoRI, HindIII 766-745
Y47βp267-F GAATTCAAGCTTCGTTTTCTTTCCTTTTCAGTTCAG EcoRI, HindIII 819-796
Y47βp389-F GAATTCAAGCTTCAAACGACATCGTTTTCGAGTT EcoRI, HindIII 941-920
Y47βp418-F GAATTCAAGCTTTTATTATTTTTTTCTTTTTTTCTTC EcoRI, HindIII 971-947
Y47βp-F GAATTCAAGCTTTTTCAAATAACAGATCATCAAG EcoRI, HindIII 195-174
Y47βp-R GAGCTCGGATCCCTTGCTTGTGTGATGGAAGTG SacI, BamHI 553-573
Y47βΔUTR-F TTTTCTTTTTCTCAAACGACATCGTTTTCG 962-953 plus 943-924
Y47βΔUTR-R GTCGTTTGAGAAAAAGAAAAAAATAATAATGGGG 934-943 plus 953-976
β01 GTAGGTACCACTACGCTACGCAGCAGCC KpnI 1290-1308
β02 AGTGGTACCTACCCTCCCAGGGGTACAC KpnI 1283-1265
β03 GTAGAAACCACTACGCTACGCAGCAGCC 1290-1308