Skip to main content

Table 1 Sequences of primers for real-time RT-PCR

From: Increased Expressions of IL-22 and Th22 cells in the coxsackievirus B3-Induced mice acute viral myocarditis

Molecule Sequence (5′~3′)
TNF-α sense: AGTCCGGGCAGGTCTACTTT
[GenBank:21926] anti-sense: TTGGACCCTGAGCCATAATC
IL-6 sense: ACAGAAGGAGTGGCTAAGGACC
[GenBank:16193] anti-sense: TAGGCATAACGCACTAGGTTT
IL-22 sense: CGATTGGGGAACTGGACCTG
[GenBank:50929] anti-sense: GGACGTTAGCTTCTCACTTT
IL-22R1 sense: CTACGTGTGCCGAGTGAAGA
[GenBank:230828] anti-sense: AAGCGTAGGGGTTGAAAGGT
IL-10R2 sense: GCCAGCTCTAGGAATGATTC
[GenBank:16155] anti-sense: AATGTTCTTCAAGGTCCAC
CVB3 sense: CGGTACCTTTGTGCGCCTGT
[GenBank:JQ040513.1] anti-sense: CAGGCCGCCAACGCAGCC
IFN-γ sense: CTCAAGTGGCATAGATGTGGAAG
[GenBank:15978] anti-sense: GCTGGACCTGTGGGTTGTTGA
IL-1β sense: CAGGATGAGGACATGAGCACC
[GenBank:16176] anti-sense: CTCTGCAGACTCAAACTCCAC
IL-17A sense: GTGTCTCTGATGCTGTTG
[GenBank:16171] anti-sense: AACGGTTGAGGTAGTCTG
β-actin sense: AATTCCATCATGAAGTGTGA
[GenBank:11461] anti-sense: ACTCCTGCTTGCTGATCCAC