Skip to main content

Advertisement

Table 1 Primers used for recombinant A33 construction by site-directed mutagenesis of the A33R VACV gene

From: Epitope mapping by random peptide phage display reveals essential residues for vaccinia extracellular enveloped virion spread

Mutation Primer sequencea
D115A ACATTCAGCATACCAGTTATTCTCGGATGCTAAAGCAAATTGCACTGCGG
Y116A ACATTCAGACGCACAGTTATTCTCGGATGCTAAAGCAAATTGCACTGCGG
Q117A ACATTCAGACTACGCATTATTCTCGGATGCTAAAGCAAATTGCACTGCGG
L118A ACATTCAGACTACCAGGCATTCTCGGATGCTAAAGCAAATTGCACTGCGG
S120A ACATTCAGATTACCAGTTATTCGCTGATGCTAAAGCAAATTGCACTGCGG
N125A ACATTCAGACTACCAGTTATTCTCGGATGCTAAAGCAGCATGCACTGCGG
E129A ACATTCAGACTACCAGTTATTCTCGGATGCTAAAGCAAATTGCACTGCGGCATCATCAAC
D115A,Q117A ACATTCAGCTTACGCATTATTCTCGGATGCTAAAGCAAATTGCACTGCGG
D115A,N125A ACATTCAGCTTACCAGTTATTCTCGGATGCTAAAGCAGCATGCACTGCGG
Q117A,N125A ACATTCAGACTACGCATTATTCTCGGATGCTAAAGCAGCATGCACTGCGGAATCATCAAC
L118A,E129A ACATTCAGACTACCAGGCATTCTCGGATGCTAAAGCAAATTGCACTGCGGCATCATCAAC
  1. aAll primers listed in 5′-3′ direction with the position of the mutation(s) underlined. A common reverse primer was used for all reactions:
  2. AATATATAACAAGAACCCTGGTAATAGAGACCATTACAGCTTTC.