Skip to main content

Table 2 Primers for real-time PCR

From: Strong innate immune response and cell death in chicken splenocytes infected with genotype VIId Newcastle disease virus

Target RNA Primer sequence (5’-3’) Accession no. Product size (bp)
IFN-α Forward primer: CCACGACATCCTTCAGCACCT Reverse primer: TGAGGAGGCTTTGGCGTTG NM_205427.1 89
IFN-β Forward primer: TGCACAGCATCCTACTGCTCTTG Reverse primer: GTTGGCATCCTGGTGACGAA NM_001024836.1 83
IFN-γ Forward primer: AGCATTTGAACTGAGCCATCACC Reverse primer: CGTCAGCTACATCTGAATGACTTG NM_205149.1 181
β-actin Forward primer: ATTGTCCACCGCAAATGCTTC Reverse primer: AAATAAAGCCATGCCAATCTCGTC NM_205518.1 113
M Forward primer: GCTTGTGAAGGCGAGAGGTG Reverse primer: AACCTGGGGAGAGGCATTTG -- a 99
  1. a: primers for viral M gene were designed based on the results of sequence comparison as described in the Methods.