Skip to main content

Table 1 The primers of Identification of rMVA-mep by PCR

From: Multiple linear epitopes (B-cell, CTL and Th) of JEV expressed in recombinant MVA as multiple epitope vaccine induces a protective immune response

Gene

Primer (from 5’ to 3’)

Mep

Forward primer: ctcgagatgccgaccaccggcgaagcgca

Reverse primer: catatgatttttataaaaatttaaaacacctgatgcaccgcacggccgatgctag

K1l

Forward primer: gaatgcacatacataagtaccggcatctctagca

Reverse primer: caccagcgtctacatgacgagcttccgagtt

MVA (wild)

Forward primer: acataagtaccggcatctctagcacacagc

 

Reverse primer: ttcgccggtggtcggcatctcgagagctac