Skip to main content

Advertisement

Table 1 The primers of Identification of rMVA-mep by PCR

From: Multiple linear epitopes (B-cell, CTL and Th) of JEV expressed in recombinant MVA as multiple epitope vaccine induces a protective immune response

Gene Primer (from 5’ to 3’)
Mep Forward primer: ctcgagatgccgaccaccggcgaagcgca
Reverse primer: catatgatttttataaaaatttaaaacacctgatgcaccgcacggccgatgctag
K1l Forward primer: gaatgcacatacataagtaccggcatctctagca
Reverse primer: caccagcgtctacatgacgagcttccgagtt
MVA (wild) Forward primer: acataagtaccggcatctctagcacacagc
  Reverse primer: ttcgccggtggtcggcatctcgagagctac