Skip to main content

Advertisement

Table 1 Sequences of bovine primer pairs used for qRT-PCR

From: Bovine herpes virus type 1 induces apoptosis through Fas-dependent and mitochondria-controlled manner in Madin-Darby bovine kidney cells

Gene Forward primer (5–3) Reverse primer (5–3) Product(bp) Accession no.
Bax TCTCCCCGAGAGGTCTTTTT TGATGGTCCTGATCAACTCG 151 XM_003585205.1
Bcl-2 ATGTGTGTGGAGAGCGTCAA CTAGGGCCATACAGCTCCAC 146 NM_001166486.1
GAPDHF ATGCTGGTGCTGAGTATGTG CTTCTGGGTGGCAGTGAT 293 XM_001252511.3