Skip to main content

Advertisement

Table 1 Primer sequences

From: Induction of interleukin-10 is dependent on p38 mitogen-activated protein kinase pathway in macrophages infected with porcine reproductive and respiratory syndrome virus

Name Sequence
IL-10 F CGGCGCTGTCATCAATTTCTG
IL-10 R CCCCTCTCTTGGAGCTTGCTA
Cyclophilin F AATGGCACTGGTGGCAAGTC
Cyclophilin R GATGCCAGGACCCGTATGC
ORF5 F GGGGTACCATGTTGGGGAAATGCT
N189 R CGGGATCCCTATAAAGGGGTTGCCACGG
N125 R CGGGATCCCTAAATGACGAAGCAAATCAACGC
N65 R CGGGATCCCTACTCCACTGCCCAGTCAAAT
C126 F GGGGTACCAGGCTTGCGAAGAACTGC
C66 F GGGGTACCACTTTTGTCATCTTTCCCGTG
C30 F GGGGTACCAACGCCAACAGCAACAGC
ORF5 R CGGGATCCCTAGAGACGACCCCAT
  1. Restriction enzyme sites are underlined.