Skip to main content

Table 1 Oligonucleotides used in this work

From: Molecular characterization of totiviruses in Xanthophyllomyces dendrorhous

Name Position or application Sequence (5’-3’)
NBA1 Tailing of dsRNAs (PO4)-GCAATTGTACGCCTGGAGCGC-(NH2)
NBA-1 Complementary to NBA1 GCGCTCCAGGCGTACAATTGCG
Mot4F Conserved motif 4 of RdRp of XdV-L1A GAGGACTTCAATAGTCAACA
Mot5R Conserved motif 5 of RdRp of XdV-L1A AAGTCGTCAGCCTCCACCCC
Mot6R Conserved motif 6 of RdRp of XdV-L1A AGACATCGTCTCCGTTGTGC
L8.2R CP ORF of XdV-L1A CCGTGTAGAGCTAAAATACC
SR4 CP ORF of XdV-L1A AAGCGCATCTTCTGGGCTCA
LIVR3 CP ORF of XdV-L1B CCTCTGCTGATCTGAAATGTT
Cap288R CP ORF of XdV-L1B GAAGTTTTCGCCCACAAGAG
Mot4FB Conserved motif 4 of RdRp of XdV-L1B GAAGATTTCAACAGTCAACATAG
Mot5RB Conserved motif 5 of RdRp of XdV-L1B ATGTCGTTAACCTCCAGCCC
Mot6RB Conserved motif 6 of RdRp of XdV-L1B GCACGTCGTCGCCGTTATG
L1AF RT-qPCR, specific for XdV-L1A GCGAAAATGAAGCGATGACA
L1AR RT-qPCR, specific for XdV-L1A TTAGTCTCCGCGCCCTTCTA
L1BF RT-qPCR, specific for XdV-L1B GACGAACTGATGCCCAAACA
L1BR RT-qPCR, specific for XdV-L1B CCGGAGACAGCUCAUUGUA
Random hexamer Random cloning NNNNNN
M13F Vector GTAAAACGACGGCCAGT
M13R Vector AACAGCTATGACCATG
  1. F, forward; R, reverse.