Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 2 Relative quantitative real-time PCR primers for targeted transcripts mRNAs

From: Induction of antigen-specific immune responses in mice by recombinant baculovirus expressing premembrane and envelope proteins of West Nile virus

Targeted transcriptsa Primer sequence (5’to 3’) Conditions
Forward Reverse
β-actinb CACTGCCGCATCCTCTTCCTCCC CAATAGTGATGACCTGGCCGT 50°C 2min; 94°C 10min 40 cycles (94°C 15s then 60°C 1min)
  1. a Mouse derived targeted transcripts. bHouse keeping gene for internal control.