Skip to main content

Advertisement

Table 1 Primers used for sequencing reactions

From: Co-circulation of two genotypes of dengue virus serotype 3 in Guangzhou, China, 2009

Primer Name Locationa Sequence (5'-3') Product (bp)
F1 1-22 AGTTGTTAGTCTACGTGGACCG 1054
R1 1036-1054 CGTGGGCTTGTTCTTAGCC  
F2 857-877 GCCCATTACATAGGCACTTCC 1199
R2 2036-2055 CTTTCCCCAAAAGGAGGTTC  
F3 1946-1965 GAGGATGGACAAGGGAAAGC 1403
R3 3326-3348 CACCATTCGTGTATCAACTTCCC  
F4 3224-3245 GGAAAATTGGAGCTGGACTTCA 1001
R4 4206-4224 GCCACTAATGGTCCAGCCA  
F5 4112-4131 CTCAAAAGGAGAAGCTGGCC 1208
R5 5299-5319 CGCATTGTGAACGTTGCGTG  
F6 5252-5274 GCAACAAAATCTGAACACACAGG 1071
R6 6301-6321 GAATAAGTGCGGGCATCAAGC  
F7 6059-6077 AAGTCAGCCGCCATAGACG 1389
R7 7428-7447 AGGTGATCCTTCCCAGAGTG  
F8 7032-7049 AGGCAGTGGTCCTGATGG 1143
R8 8153-8174 GCATTCCTCCATGTTTCCTTTG  
F9 8015-8032 TCACCAAGCCCAACAGTG 1528
R9 9520-9542 TGGCCATTCTTTTTAACCTCTCC  
F10 9270-9293 AGCTCACATACCAAAACAAAGTGG 1060
R10 10299-10318 AGCTTCTTCCGTACTGTGGC  
F11b 10118-10137 GGTCTCACTTCCAGAGCAAC 590
R11 10674-10696 AGAACCTGTTGATTCAACAGCAC  
5'RACE outer primer 661-678 TTGCACGTTCCATAGGTC  
5'RACE inner primer 267-284 CTGCTGTTGGTGGAATGG  
  1. a Primer location refers to DENV-3 strain 80–2 [GenBank: AF317645].
  2. b Primer F11 was also used as 3’RACE primer.