Skip to main content

Table 1 Primer sets used in study

From: Genetic characterization of Chikungunya virus from New Delhi reveal emergence of a new molecular signature in Indian isolates

Primer Name Sequence 5′-3′ Genome position Amplicon size bps Reference Where used in study
E1-primary-F ACAAAACCGTCATCCCGTCTC 10145–11158 1013 [7] Primary PCR
E1-primary-R TGACTATGTGGTCCTTCGGAGG
E1-F1 GCTCCGCGTCCTTTACC 10389–10943 555 [8] Nested PCR, Phylogenetic analysis
E1-R1 ATGGCGACGCCCCCAAAGTC
E1-gene-F GCGTACGAACACGTAACA 9991–11310 1320 This study Molecular signatures
E1-gene-R GTGCCTGCTGAACGACAC
E2-gene-F AGCACCAAGGACAACTTCAAT 8542–9807 1266 This study Phylogenetic analysis Molecular signatures
E2-gene-R TTTAGCTGTTCTGATGCAGC