Skip to main content

Table 2 Primers for viral screening

From: Exhaled breath condensate sampling is not a new method for detection of respiratory viruses

Primer or probe Gene Position Sequence (5'→ 3') Reference
HRSV     
RT-PCR primers     
HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9]
HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9]
HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9]
HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9]
MGB probes     
HRSV-A TP F 697-715 cagactactagagattacc [8, 9]
HRSV-B TP N 461-477 tatcatcccacagtctg [8, 9]
INFLUENZA A     
AM_FW155 M 151-174 catggaatggctaaagacaagacc [7]
AM_RV397 M 374-397 aagtgcaccagcagaataactgag [7]
INFLUENZA B     
BHA_FW188 HA 188-209 agaccagagggaaactatgccc [7]
BHA_RV347 HA 324-347 ctgtcgtgcattataggaaagcac [7]
PARAINFLUENZA     
PIV1FW HN 748-768 ccttaaattcagatatgtat [4]
PIV1RV HN 1206-1225 gataaataattattgatacg [4]
PIV2 FW HN 803-822 aacaatctgctgcagcattt [4]
PIV2 RV HN 1291-1310 argtcagacaatgggcaaat [4]
PIV3 FW HN 762-781 ctgtaaactcagacttggta [4]
PIV3 RV HN 1220-1239 tttaagcccttgtcaacaac [4]
PIV4 FW P 531-552 gaaagaggcttgggttacaca [21]
PIV4 RV P 1147-1168 gctcttatcacagtctccaaa [21]
HMPV     
HMPV_N3F N 357-379 gagaagagctgggtagaa [6]
HMPV_N3R N 716-733 caaacaaactttctgct [6]
CORONA     
PanCoV FW RdRp 13717-13739* acwcarhtvaayytnaartaygc [5]
PanCoV RV RdRp 13948-13967* tcrcayttdggrtartccca [5]
ADENO     
AdFW Hexon 21-46 gccscartggkcwtacatgcacatc [22]
AdRV Hexon 301-322 cagcacsccicgratgtcaaa [22]
RV     
RV_5UTR_FW 5'UTR 186-203 caagcacttctgtttccc [23]
RV_5UTR_RV 5'UTR 566-584 cacggacacccaaagtagt [23]
  1. *Nucleotide positions for reference strain CoV NL63 (DQ445912)