Skip to main content

Table 5 The amino acids sequence and nucleotide sequence of multi-mimotope of influenza A

From: Mimotopes selected with neutralizing antibodies against multiple subtypes of influenza A

E T K A W W L G S G G S Q A H N W Y N H K P L P G S G
gaaactaaagcatggtggctgggttctggtggttctcaggctcataactggtataaccataagccactgccaggttccggt
G S Q W T W T Q Y G S G G S D C W Q M D R K T C P L G
ggttctcagtggacttggacgcagtacggtagcggtggctccgactgttggcagatggatcgcaaaacctgtccactgggt
S G G S W P W H N H R G S G G S V W S T P P H A D G P
tctggcggtagctggccttggcataaccatcgtggcagcggtggttctgtttggtctactccaccgcatgctgatggtcca
A G S G G S W H W R L P S G S G G S W H T H K W S L S
gctggctctggcggttcttggcattggcgtctgccatctggctctggtggttcttggcacactcacaaatggtctctgtct
A K A
gctaaagca