Skip to main content

Advertisement

Table 1 Primers employed for the amplication of unknown genomic RNA of rabies virus aG strain

From: Molecular characterization of China rabies virus vaccine strain

Fragments Sequence(5'-3') Lengths(bases) Base position
F1aFb ACGCTTAACAACAAGATCA 19 1-1581
F1R CTTCAGCCATCTCAAGAT 18  
F2F TATGTCTCAGTCAGTTCC 18 1340-2933
F2R TCATCCCAAGTGATCTCC 18  
F3F ATACTCTGGGAATCATAGGAT 21 2742-4280
F3R TGAGACGTCTGAAACTCACTG 21  
F4F AACATGGGTCGCGATGCA 18 4090-5453
F4R GGTCATCATAGACCTCTC 18  
F5F CATGTAGATTCTCATAAT 18 5063-6410
F5R TAAATACAGGAAAGTCTC 18  
F6F TGTGGAAACTCCGGCTAT 18 6290-7430
F6R CGATGAGGTCTGATCTGTCTG 21  
F7F TGTTTGGATTGAAGAGAGTGT 21 7344-8513
F7R GCTCACTGAGAAATCGAG 18  
F8F TTCAGAGTTTCGAGAGGCAAT 21 8410-9648
F8R ATGTTGACAGGGAAGATGGTT 21  
F9F ATGTTCCAGCCATTGATGCTT 21 9272-10598
F9R TGAACACAAGCTTGGCATCAG 21  
F10F TGCTCTGCTCAACAGGTT 18 10331-11932
F10R ACGCTTAACAAATAAACAACA 21  
F11F GGTCTGGCGACACCCCGGTGTTCA 24  
F11R GAGTCTGTCATCTCACTGGATCA 23  
F12F TGCTGCTGCCAAGTAGGAACAT 22  
F12R AGTTTGGCGGCATCCATGCCTG 22  
  1. a The 12 fragments are labeled from "F1" to "F12"
  2. b "F" and "R" strand for forward and reverse direction of the primer extension