Skip to main content

Table 1 Primers used in the present study

From: An antisense transcript in the human cytomegalovirus UL87 gene region

Primers positions of 5'end @ Sequences of primers (5'-3')
3' adaptor outer primer   TACCGTCGTTCCACTAGTGATTT
3' adaptor inner primer   CGCGGATCCTCCACTAGTGATTTCACTATAGG
5' adaptor outer primer   CATGGCTACATGCTGACAGCCTA
5' adaptor inner primer   CGCGGATCCACAGCCTACTGATGATCAGTCGATG
M13F   GTTTTCCCAGTCACGAC
M13R   CAGGAAACAGCTATGAC
F1 UL87 AS
5' RACE primers
129553 GAGAACCCGACCCGTAAA
F2   129806 GTCGGAGACGGGAGAAG AGG
F3   130459 GTTCAAAGCGGCTACGGCCAT
F4   130029 AACGCTTTCAACACCAACCGCG
R1 UL87 AS
3' RACE primers
129829 CTCCTCTTCTCCCGTCTCC
R2   130049 GCGGTTGGTGTTGAAAGC