Skip to main content

Advertisement

Table 1 Summary of primer sequences encompassing the EBV types and variants

From: Characteristics of epstein barr virus variants associated with gastric carcinoma in Southern Tunisia

EBV genes and regions
(types or variants)
Primer sequences (5'-3') Product size (bp)
EBNA-3C gene
(type A or B)
F: AGAAGGGGAGCGTGTGTTGT
R: GGCTCGTTTTTGACGTCGGC
PCR products
153: type A
246: type B
BamH1-W region
(type C or D)
F: ACCTGCTACTCTTCGGAAAC
R: TCTGTCACAACCTCACTGTC
PCR+ Bam HI digestion
205: type C
130+75: type D
BamH1-F region
(f variant)
F: TCCCACCTGTTACCACATTC
R: GGCAATGGGACGTCTTGTAA
PCR+ Bam HI digestion
198: F variant
127+71: f variant
Exon 1 of BNLF1 gene
( XhoI variant)
F: ACAATGCCTGTCCGTGCA
R: AGAAACACGCGTTACTCT
PCR+ Xho I digestion
497: Xho I-
340+157: Xho I+
Exon 3 of BNLF1 gene
(30bpdel-LMP1)
F: TGGAGGGAGAGTCAGTCAGGC
R: ATTGACGGAAGAGGTTGAAAAC
PCR products
224: 30bpdel-LMP1
254: wt-LMP1
  1. F: Forward primer
  2. R: Reverse primer