Skip to main content

Advertisement

Table 1 Summary of primer sequences encompassing the EBV types and variants

From: Characteristics of epstein barr virus variants associated with gastric carcinoma in Southern Tunisia

EBV genes and regions (types or variants) Primer sequences (5'-3') Product size (bp)
EBNA-3C gene (type A or B) F: AGAAGGGGAGCGTGTGTTGT R: GGCTCGTTTTTGACGTCGGC PCR products 153: type A 246: type B
BamH1-W region (type C or D) F: ACCTGCTACTCTTCGGAAAC R: TCTGTCACAACCTCACTGTC PCR+ Bam HI digestion 205: type C 130+75: type D
BamH1-F region (f variant) F: TCCCACCTGTTACCACATTC R: GGCAATGGGACGTCTTGTAA PCR+ Bam HI digestion 198: F variant 127+71: f variant
Exon 1 of BNLF1 gene ( XhoI variant) F: ACAATGCCTGTCCGTGCA R: AGAAACACGCGTTACTCT PCR+ Xho I digestion 497: Xho I- 340+157: Xho I+
Exon 3 of BNLF1 gene (30bpdel-LMP1) F: TGGAGGGAGAGTCAGTCAGGC R: ATTGACGGAAGAGGTTGAAAAC PCR products 224: 30bpdel-LMP1 254: wt-LMP1
  1. F: Forward primer
  2. R: Reverse primer