Skip to main content

Advertisement

Table 2 Oligonucleotide primers used in the production of the RNAi construct

From: RNA interference-based resistance against a legume mastrevirus

Primer Orientation Primer sequences# Cloning sites*
Chp6SF sense/forward 5'CCAACTCGAG TTATCAAGCTGGACAAGAGC 3' Xho I
Chp6SR sense/reverse 5'CCTCCCATGG TTCGCCTTAAACAGAAGG 3' Nco I
Chp6ASF antisense/forward 5'CCTCTCTAGA TTCGCCTTAAACAGAAGG 3' Xba I
Chp6ASR antisense/reverse 5'CCAATCTAGA TTATCAAGCTGGACAAGAGC 3' Xba I
  1. * Restriction endonuclease recognition sequences introduced into the primers to facilitate cloning of fragments into pFGC5941.
  2. # The introduced restriction endonuclease recognition sequences are underlined.