Skip to main content

Table 3 Oligonucleotide primers used in this study

From: Reactions of Nicotiana species to inoculation with monopartite and bipartite begomoviruses

Primer Sequence Predicted size of amplification product (base pairs)
RDRf CGAGCCAGTTGCGGGATAATTC 269, 341
RDRr GAGCAAAGTCAGCAGATATT  
CLCV1 CCGTGCTGCTGCCCCCATTGTCCGCGTCAC 1102
CLCV2 CTGCCACAACCATGGATTCACGCACAGGG  
PK3AV2F AAATATCGATATGTGGGATCCACTATTAAACG 311
PK3AV2R TCTGGTCGACCTATACATGGGCCTGTTTGT  
BegomoF ACGCGTGCCGTGYTGCTGCCCCATTGTCC ~2800
BegomoR ACGCGTATGGGCTGYCGAAGTTSASACG  
ToLCNDV2F GTCGACAAACATGTGGGATCCATTATTGC 352
ToLCNDV2R ATCGATCTTCTATACATTCTGTACATTC  
TLCNDV1 GCAGATATCATCATTTCAACGC 642
TLCNDV2 CATACTTGCCGGCCTCTTGTTG