Skip to main content

Table 1 Primers used in this study for amplification of the full-length genome of SX09S-01 strain.

From: Isolation and molecular characterization of genotype 1 Japanese encephalitis virus, SX09S-01, from pigs in China

Segments Primers Oligonucleotide sequence (5'-3') Positiona Length (bp) Annealing temperature (°C)
S1 P1Sb 5'--- AGAAGTTTATCTGTGTGGACTTC---3' 1-23 1795 58
  P1Rc 5'--- CCACCACGATGGCTCCTGC---3' 1777-1795   
S2 P2S 5'--- TGYTGGTCGCTCCGGCTTA---3' 956-974 1582 57
  P2R 5'--- AAGATGCCACTTCCACAYCTC ---3' 2517-2537   
S3 P3S 5'--- GACACTGGATGTGCCATTG---3' 2479-2497 2310 57
  P3R 5'---TCTTTTTGTTGTTTTTAAAG---3' 4589-4608   
S4 P4S 5'--- GTTGGACGACGACGGCGACTTTC---3' 4449-4471 2648 58
  P4R 5'--- AGGTGATTAGGTGCTTCAGGAGAGG---3' 7072-7096   
S5 P5S 5'--- GGTCGGAGTGGTGGCAGCAAATG---3' 6894-6916 2200 58
  P5R 5'--- CCCTTTAGCCTTTCCGAACTCTCCG---3' 9069-9093   
S6 P6S 5'--- AGGAGTCAAGGAAGTGCTCAACG---3' 8787-8809 2178 58
  P6R 5'--- AGATCCTGTGTTCTTCCTCACCACC ---3' 10940-10964   
  1. a Numbers indicate the location of the nucleotide sequence of XJ69
  2. b S represents the sense primer.
  3. c R represents the anti-sense primer