Skip to main content

Advertisement

Table 1 siRNA and oligo-primer sequences for this study:

From: ISG15 facilitates cellular antiviral response to dengue and west nile virus infection in vitro

No. Sequence (5'-3') Note
1 CAGUGAUGCUAGUGGUACAtt siRNA seq for mouse gene Isg15
2 GCAUCCCUCUUAACCCGGtt siRNA seq for mouse gene Socs1
3 GCAUCUUUGUCGGAAGACUtt siRNA seq for mouse gene Socs3
4 AGAGGGAAATCGTGCGTGAC Forward primer for Quantitative-PCR of mouse beta-actin
5 CAATAGTGATGACCTGGCCGT Reverse primer for Quantitative-PCR of mouse beta-actin
6 CATTCCAAGTGAGAATCTCTTTGTCA Forward primer for Quantitative-PCR of DENV E gene
7 CAGATCTCTGATGAATAACCAACG Reverse primer for Quantitative-PCR of DENV E gene
8 TTCTCGAAGGCGACAGCTG Forward primer for Quantitative-PCR of WNV E gene
9 CCGCCTCCATATTCATCATC Reverse primer for Quantitative-PCR of WNV E gene
10 GGAACGAAAGGGGCCACAGCA Forward primer for Quantitative-PCR of mouse Isg15 gene
11 CCTCCATGGGCCTTCCCTCGA Reverse primer for Quantitative-PCR of mouse Isg15 gene
12 GCCGCAGCATTAAGTGGGGGC Forward primer for Quantitative-PCR of mouse Socs1 gene
13 GGTCTCCAGCCAGAAGTGGGAGG Reverse primer for Quantitative-PCR of mouse Socs1 gene
14 TGAGCCATCTTGGAGCCCAGGT Forward primer for Quantitative-PCR of mouse Socs3 gene
15 TTGGCTGTGTTTGGCTCCTTGTGT Reverse primer for Quantitative-PCR of mouse Socs3 gene