Skip to main content

Table 1 Real-time quantitative RT-PCR primers used in this study1

From: Chicken interferon alpha pretreatment reduces virus replication of pandemic H1N1 and H5N9 avian influenza viruses in lung cell cultures from different avian species

RNA target Primer Sequence (5'-3') Species
28S F: GGCGAAGCCAGAGGAAACT C, T
  R: GACGACCGATTTGCACGTC  
GADPH F: ATGTTCGTGATGGGTGTGAA D
  R: CTGTCTTCGTGTGTGGCTGT  
IFN-α F: GACAGCCAACGCCAAAGC C, T
  R: GTCGCTGCTGTCCAAGCATT  
IFN-α F: TCCTCCAACACCTCTTCGAC D
  R: GGGCTGTAGGTGTGGTTCTG  
Mx F: CAGGACATCAACGACAATCT C, T
  R: TTGCCAGATGAGGGATAGTA  
Mx F: TCAATCACTTTCCTCACCAG D
  R: CCTTCTGCTTGTGTTGAGAC  
IL-6 F: GCGAGAACAGCATGGAGATG C
  R: GTAGGTCTGAAAGGCGAACAG  
IL-6 F: GCTCGCCGGCTTCGA T
  R: GGTAGGTCTGAAAGGCGAACAG  
IL-6 F: TTCGACGAGGAGAAATGCTT D
  R: CCTTATCGTCGTTGCCAGAT  
IL-1β F: ACATGTCGTGTGTGATGAG C
  R: CAG CCGGTAGAAGATGAAGC  
IL-1β F: GCTCTACATGTCGTGTGTGATGAG T
  R: TGTCGATGTCCCGCATGA  
IL-1β F: TCGACATCAACCAGAAGTGC D
  R: GAGCTTGTAGCCCTTGATGC  
  1. 1F, forward primer; R, reverse primer; C, chicken; T, turkey; D, duck.