Skip to main content

Advertisement

Table 1 Sequences of primers used for PCR amplification of P2X receptors inHuh-7 Cells

From: Identification of ionotrophic purinergic receptors in Huh-7 cells and their response towards structural proteins of HCV genotype 3a

No. Primer Name Primer Sequence: 5'-3' Sequence
1 P2X2- F CAGGTTTGCCAAATACTACAAGATCA
2 P2X2 -R AACTTCCCGGCCTGTCCAT
3 P2X3- F TCTTCACCTATGAGACCACCAAGTC
4 P2X3-R GATCAGAAGCTGAACTACTCGGTTGATG
5 P2X4 -F CTC TGCTTGCCCAGGTACTC
6 P2X4- R CCAGCTCACTAG CAAGACCC
7 P2X5- F CGCTGGGGAAGCGGTTA
8 P2X5- R GCACCAGGCAAAGATCTCACA
9 P2X6 -F GAACCACAATTCAGCCCCTA
10 P2X6 -R CAGGTCACAATCCCAGTGAA
11 GAPDH-F ACCACAGTCCATGCCATCAC
12 GAPDH-R TCCACCACCCTGTTGCTGTA