Skip to main content

Table 2 List of the oligonucleotides used in this study

From: Biotechnological approaches to determine the impact of viruses in the energy crop plant Jatropha curcas

Primer designation* Primer sequence (5' to 3')
JC1F GGAAGATAGTGGGAATGCCNCCTTTAATTTGAA
JC2R AARGAATTCATGGGGGCCCARAGRGACTGGC
JC3F RTCGACGTCATCAATGACGTTGTACCAKGCG
JC4R GTHGAYCCSCACTAYCTMAARCACTTCAARG
JC5R GGCCATCCGGTAATATTAWWCGGATGG
JC6F CCATTCATTGCTTGAGGAGCAGTG
  1. *Primer designation: F denotes forward R means reverse.
  2. Primer sequence: R represents A or G; K represents G or T; H represents A, C or T; Y represents C or T; S represents G or C; M represents A or C; W represents A or T.