Skip to main content

Table 1 Primers used for RT-PCR reactions

From: Ectopic expression of microRNA-155 enhances innate antiviral immunity against HBV infection in human hepatoma cells

Transcripts Product size(bp) Sequences (5'-3') Tm(°C) PCR cycle
β--actin 540 GTGGGGCGCCCCAGGCACCA
CTCCTTAATGTCACGCACGATTTC
60°C 28 cycles
SOCS1 301 CACGCACTTCCGCACATTCC
TCCAGCAGCTCGAAGAGGCA
55°C 35 cycles
MxA 581 ACCAGCTGAGCCTGTCCGAAGCCC
CCGGACCATATCCGTCACGGTG
60°C 35 cycles
ISG15 294 GGTGGACAAATGCGACG
ATGCTGGTGGAGGCCCTTAG
60°C 28 cycles
OAS-1 356
454
ACACATTTCAACACAGCCCA
TGCAGGTCCAGTCCTCTTCT
60°C 35 cycles
APOBEC3B 981 GTTTGTATCCTGGACCCCCT
GAGATGGTGGTGAACGGTCT
60°C 30 cycles
HBx 250 CCGTCTGTGCCTTCTCATCTGC
CCTCCGACATCCGTATTTAACCA
60°C 28 cycles
pri-miR-155 307 AGGTGGCACAAACCAGGAA
GTTGAACATCCCAGTGACCAG
58°C 38 cycles