Skip to main content

Table 1 Sequences of primers used in real time PCR

From: Canine distemper virus induces apoptosis in cervical tumor derived cell lines

Primers Nucleotide Sequence Length (nt) Fragment size GenBank access number
HsCasp3Forw 5'- TGCATACTCCACAGCACCTGGTTA-3' 24 82 bp NM_032991.2
HsCasp8Forw 5'- TTTCACTGTGTTAGCCAGGGTGGT A-3' 24 84 bp NM_033355.3
HsGapdhForw 5'- TTCCAGGACCAAGATCCCTCCAAA - 3' 24 86 bp XM_001725661