Skip to main content

Table 1 Primer and probe sequences, reaction concentrations, and annealing temperatures used for RT-rtPCR assays.

From: Real-world comparison of two molecular methods for detection of respiratory viruses

Virus (target) Forward primer μM Reverse primer μM Probe (5' to 3') μM °C Ref
HRV (5' UTR)$ CY+AGCC+TGCGTGGC 0.8 GAAACACGGACACCCAAAGTA 0.8 TCCTCCGGCCCCTGAATGYGGC 0.1 60 [20]
1st Round RSV (M) GGAAACATACGTGAACAAGCTTCA 1 A: CATCGTCTTTTTCTAAGACATTGTATTGA 0.5 TGTGTATGTGGAGCCTTCGTGAAGCAAG 0.2 60 [19]
    B: TCATCATCTTTTTCTAGAACATTGTACTGA 0.5     
2nd Round RSV (M) GGCAAATATGGAAACATACGTGAA 1 TCTTTTTCTAGGACATTGTAYTGAACAG 1 CTGTGTATGTGGAGCCTTCGTGAAGCT 0.2 60 [18]
1st Round HMPV (N) CATATAAGCATGCTATATTAAAAGAGTCTC 1 CCTATTTCTGCAGCATATTTGTAATCAG 1 TGYAATGATGAGGGTGTCACTGCGGTTG 0.2 60 [21]
2nd Round HMPV (N) CATAYAARCATGCTATATTAAAAGAGTCTC 1 CCTATYTCWGCAGCATATTTGTAATCAG 1 CAACHGCAGTRACACCYTCATCATTRCA 0.2 60 *
HCoV OC43 (N) CGATGAGGCTATTCCGACTAGGT 1 CCTTCCTGAGCCTTCAATATAGTAACC 1 TCCGCCTGGCACGGTACTCCCT 0.5 60 [22]
HCoV 229E (N) CAGTCAAATGGGCTGATGCA 1 AAAGGGCTATAAAGAGAATAAGGTATTCT 1 CCCTGACGACCACGTTGTGGTTCA 0.5 60  
HCoV-NL (N) AGGACCTTAAATTCAGACAACGTTCT 1 GATTACGTTTGCGATTACCAAGACT 1 TAACAGTTTTAGCACCTTCCTTAGCAACCCAAACA 0.5 66 [17]
PIV 1 (N) GGATATCCTGCATGTCTCGG 1.5 GGCACTTTTAACGGTTCCATC 1.5 CCATAACAAGTAGTGCTGGTCTAAGAAAAGGATTCTTC 0.2 60 *
PIV 2 (N) CACTTAAATATGGACTTGGAACAAGATG 1.5 TCCATCAGYTTTGGTGATTCTAATAGAG 1.5 CTACATTATCAGAGTCTAGGACCCATGGCCAA 0.2 60 *
PIV 3 (N) AGCCATGCAACAGTATGTGACG 1.5 TTRGMTTCGTGTGTCACTCCAAGTTC 1.5 ATYTGAGCTTCRGCATCACGTGCTACTG 0.2 60 *
Flu A (M) GACCRATCCTGTCACCTCTGAC 0.8 AGGGCATTYTGGACAAAKCGTCTA 0.8 TGCAGTCCTCGCTCACTGGGCACG 0.2 55 §
Flu B (NS) TCCTCAACTCACTCTTCGAGCG 0.8 CGGTGCTCTTGACCAAATTGG 0.8 CCAATTCGAGCAGCTGAAACTGCGGTG 0.2 55 §
  1. $ HRV forward primer: + = LNA base.
  2. * this manuscript
  3. § CDC protocol (World Health Organization. CDC Protocol of Realtime RTPCR for Swine Influenza A (H1N1). April 28, 2009. http://www.who.int/csr/resources/publications/swineflu/CDCrealtimeRTPCRprotocol_20090428.pdf).