Skip to main content

Table 1 List of primers used in this study

From: Cellular transcriptional profiling in human lung epithelial cells infected by different subtypes of influenza A viruses reveals an overall down-regulation of the host p53 pathway

Primers & probes Sequence 5'-3'
p53 (Exon8-9) Forward GAA GAG AAT CTC CGC AAG AAA GG
  Reverse TCC ATC CAG TGG TTT CTT CTT TG
  Probe AGC ACT AAG CGA GCA CTG CCC AAC
p21 Forward GACTCTCAGGGTCGAAAACGG
  Reverse GCGGATTAGGGCTTCCTCTT
  Probe CTACCACTCCAAACGCCGGCTGATCT
Bax Forward ACTCCCCCCGAGAGGTCTT
  Reverse GCAAAGTAGAAAAGGGCGACAA
  Probe GAGCTGACATGTTTTCTGACGGCAACTTCAACT
Bcl-XL Forward TCC TTG TCT AGG CTT TCC ACG
  Reverse GGT CGC ATT CTC GCC TTT
  Probe ACA GTG CCC CGC CGA AGG AGA
Influenza M Forward CTTCTAACCGAGGTCGAAACGTA
  Reverse GGTGACAGGATTGGTCTTGTCTTTA
  Probe TCAGGCCCCCTCAAAGCCGAG