Skip to main content

Table 1 Oligonucleotides used for amplification of the haemagglutinin and neuraminidase genes of H5N1

From: Genetic drift evolution under vaccination pressure among H5N1 Egyptian isolates

Name Sense Primer sequence (5'-3') Product size Reference
HA a For agcraaagcaggggt 699  
  Rev ctctgrttyagtgttgatgt   FLI -Germany*
HA b For gagcagaataaaycattttgaga 801  
  Rev tgagtggattctttgtctgcagc   
HA c For acatcaacactraaycagag 716  
  Rev aagtctagagttctctcattyt   
HA d For gctgcagacaaagaatccactca 615  
  Rev gaccagtagaaacaagggtgtttt   
NA For atgaatccaaatcagaag 1345 [13]
  Rev tgtcaatggtgaatggcaac   
  1. *Primer sequences for HA (a-d) were ordered according to information provided by Dr. Sasan R Fereidouni, the Laboratory of Molecular and Biological Characterization of AIV, Friedrich Loeffler Institute, Germany.