Genetic drift evolution under vaccination pressure among H5N1 Egyptian isolates

Table 1 Oligonucleotides used for amplification of the haemagglutinin and neuraminidase genes of H5N1

Name	Sense	Primer sequence (5'-3')	Product size	Reference
HA a	For	agcraaagcaggggt	699
	Rev	ctctgrttyagtgttgatgt		FLI -Germany*
HA b	For	gagcagaataaaycattttgaga	801
	Rev	tgagtggattctttgtctgcagc
HA c	For	acatcaacactraaycagag	716
	Rev	aagtctagagttctctcattyt
HA d	For	gctgcagacaaagaatccactca	615
	Rev	gaccagtagaaacaagggtgtttt
NA	For	atgaatccaaatcagaag	1345	[13]
	Rev	tgtcaatggtgaatggcaac

*Primer sequences for HA (a-d) were ordered according to information provided by Dr. Sasan R Fereidouni, the Laboratory of Molecular and Biological Characterization of AIV, Friedrich Loeffler Institute, Germany.

ISSN: 1743-422X