Skip to main content

Table 1 Sequences of primers for PCR

From: Distinct different expression of Th17 and Th9 cells in coxsackie virus B3-induced mice viral myocarditis

Molecule Sequence (5' -3') Length
IL-17 sense:5'GTCAATGCGGAGGGAAAG 3' 349 bp
[GenBank:16171] antisense:5'CACGAAGCAGTTTGGGAC 3'  
β-actin sense: 5'CCAGCCTTCCTTCTTGGGTAT 3' 102 bp
[GenBank:11461] antisense: 5'TTGGCATAGAGGTCTTTACGG 3'  
IL-9 PCR1 sense: 5'GCATCAGAGACACCAATTACCT 3' 140 bp
[GenBank:16198] PCR1 antisense: 5' TTAAGGAGGGGAGGTTTTGTA 3'  
  PCR2 sense: 5'AACTGATGATTGTACCACACCGTGC 3'  
  PCR2 antisense: 5' AGGACGGACACGTGATGTTCTTTAG 3'