Skip to main content

Table 1 Primers designed for PCR

From: Identification of CD8+ cytotoxic T lymphocyte epitopes from porcine reproductive and respiratory syndrome virus matrix protein in BALB/c mice

primer Sequence (5'-3') Note
M-F CCCAAGCTT AGC ATG GGGTCGTCTCTAGA Hind III
M-R CCGCTCGAG CTA TTTGGCATATTTGACA Xho I
Ub-F TCAGGATCC GCCGCCGCC ATG CAGATTTTCGTG BamH I
Ub-R GGAGCCTGGAGAAGCACCTCTCAGGCGAAGGAC  
Truncated-M-F CCGGAATTC ATGGGAGTGTACTCGGCCATAG EcoR I
Truncated-M-R CCGCTCGAG CTATTTGGCATATTTGAC Xho I
Fusion-M-Ub-F TCTCCAGGCTCC ATGGGGTCGTCTCTA Linker
Fusion-M-Ub-R GGAGCCTGGAGA AGCACCTCTCAGGCGAAGGAC Linker
pSC11-M-F ATAGTCGAC GCCGCCGCC ATG GGGTCGTCTCTAG Sal I
pSC11-M-R GCCGTCGAC CTA TTTGGCATATTTGACAAGGTTTAC Sal I
P7.5-F GCACGGTAAGGAAGTAGAAT  
  1. Note: The bold letter of primers are start or stop codons; the underlined sequence of primers represents the Kozak motif or the linker sequence.