Skip to main content

Table 1 Primer sets used to clone NoV capsid regions, HRV VP7, and HAV VP1/P2A.

From: Standardized positive controls for detection of norovirus by reverse transcription PCR

Virus, region Primers and Sequences (5'→3') Location Application
NoV GI Capsid GI-FIM; CTGCCCGAATTYGTAAATGATGAT 5342-5365a Onestep RT-PCR
  GI-RIM; CCAACCCARCCATTRTACATYTG 5649-5671a Onestep RT-PCR and Semi-nested PCR
  GI-F2; ATGATGATGGCGTCTAAGGACGC 5358-5380a Seminested PCR
NoV GII Capsid GII-FIM; GGGAGGGCGATCGCAATCT 5049-5067b Onestep RT-PCR
  GII-RIM; CCRCCIGCATRICCRTTRTACAT 5367-5389b Onestep RT-PCR and Semi-nested PCR
  GII-F3M; TTGTGAATGAAGATGGCGTCGART 5079-5102b Semi-nested PCR
HRV VP7 ddrv-1; GGCGCC GCTCYTTTTRATGTATGGTATTGAATTACCAC 6-38c Onestep RT-PCR
  ddrv-2; GGCGCC CTTTAAAATANAYDGADCCWRTYGGCCA 346-373c Onestep RT-PCR
HAV VP1/P2A HAV-1F; GGCGCC ATTCAGATTAGACTGCCTTGGTA 2789-2811d Onestep RT-PCR
  HAV-1R; GGCGCC AGTAAAAACTCCAGCATCCATTTC 3365-3388d  
  HAV-2F; CTATTCAGATTGCAAATTACAAT 2886-2908d Semi-nested PCR
  HAV-2R; AACTTCATTATTTCATGCTCCT 3258-3279d  
  1. aGenBank accession number M87661
  2. bGenBank accession number X86557
  3. cGenBank accession number HQ392461
  4. dGenBank accession number AF268396