Skip to main content

Table 8 Primer used for the amplification of HBoV

From: Human bocavirus (HBoV) in children with respiratory tract infection by enzyme linked immunosorbent assay (ELISA) and qualitative polymerase chain reaction (PCR)

Primer Sequence (5'-3') Amplicon size (bp) Purpose
HBoV188F GAGCTCTGTAAGTACTATTAC 354 Qualitative
PCR
HBoV542R CTCTGTGTTGACTGAATACAG 354 Qualitative
PCR