Skip to main content

Table 1 Primer and probe sequences

From: Development of a new duplex real-time polymerase chain reaction assay for hepatitis B viral DNA detection

Primer or probe Sequence (5'-3') Nucleotide Position
Af 5'- GTCCTCCAATTTGTCCTGG -3' 2196-2214
Ar 5'- TGAGGCATAGCAGCAGGAT -3' 2276-2258
Ap 5' FAM - CTGGATGTGTCTGCGGCGTTTTATCAT - BHQ 3' 2221-2247
Bf 5'- CACCTGTATTCCCATCCCATC -3' 2443-2458
Br 5'- AGCCCTACGAACCACTGAACA -3' 2559-2539
Bp 5' FAM - AAACGGACTGAGGCCCACTCCCA -BHQ 3' 2511-2489
ICp 5' Cy5 - CCCCCCCCCCCCCCAAAAAAAA -BHQ 3'  
  1. Nucleotide sequence positions were numbered according to reference sequence AF090842 (genotype A). Probes for the detection of HBV DNA and IC were labelled with 6-carboxyfluorescein (FAM) and cyanine dye (Cy5) at the 5' end, respectively. The 3' ends of probes were labelled with Black Hole Quencher dye (BHQ). The length of PCR products amplified from set A and B are 81 bp and 117 bp, respectively.