Skip to main content

Advertisement

Table 1 Sequence of siRNA oligonucleotides directed against 5'UTR of HCV 3a genotype

From: Down-regulation of IRES containing 5'UTR of HCV genotype 3a using siRNAs

No. siRNA name Sequences 5'-3'
1 Usi170- antisense AATCGCTGGGGTGACCGGGTCCCTGTCTC
2 Usi170-sense AAGACCCGGTCACCCCAGCGACCTGTCTC
3 Usi212- antisense AATACCCAGAAATTTGGGCGTCCTGTCTC
4 Usi212- sense AAACGCCCAAATTTCTGGGTACCTGTCTC
5 Usi272- antisense AAAGGCCTTGTGGTACTGCCTCCTGTCTC
6 Usi272- sense AAAGGCAGTACCACAAGGCCTCCTGTCTC
7 Sc-antisense AACCTGCATACGCGACTCGACCCTGTCTC
8 Sc-sense AAGTCGAGTCGCGTATGCAGGCCTGTCTC