Skip to main content

Table 1 Specific primers for amplification/sequencing of Araraquara hantavirus nucleoprotein gene and amplification of betagalactosidase gene.

From: Expression of recombinant Araraquara Hantavirus nucleoprotein in insect cells and its use as an antigen for immunodetection compared to the same antigen expressed in Escherichia coli

Primers
name
Primer
Sequence
Function
For. His. 5' GAAGATCTATGCGGGGTTCTCATCAT 3' Amplification of N gene.
Rev. NP. 5 TAACCCGGGTCACAGCTTTAAGGGTCC 3' Amplification of N gene.
Int. NP. 5' AGACAGCAGACTGGAAG 3' Sequencing of N gene.
For. pSyn 5' GGGCCAAGCTTGGCGTTATTG 3' Sequencing of N gene
Rev. pSyn 5' TCTGTAAATCAACAACGCACAG 3' Sequencing of N gene
For. β-gal 5' TTCACTGGCCGTCGTTTTACAACGTCGTGA 3' Check of Recombinant Baculovírus Purity
Rev. β-gal 5' ATGTGAGCGAGTAACAACCCGTCGGATTCT3' Check of Recombinant Baculovírus Purity
  1. Primers name: For. His - Forward Histidina; Rev. NP - Reverse Nucleoprotein; Int. NP. Intermediate Nucleoprotein; For. pSyn. Forward vector pSyn; Rev. pSyn. Reverse vector pSyn; For. β-gal. Forward gene betagalactosidase; Rev. β-gal. Reverse gene betagalactosidase.