Skip to main content

Table 1 Top 20 high frequency sequences in raw sequencing data

From: Sequence characteristics of T4-like bacteriophage IME08 genome termini revealed by high throughput sequencing

read sequence frequencies genome presence
  rank total 1.fq 2.fq Ori1 Pos2 Junction3
GCTCTTCGGAAAGGTCAAAAACAGTTTGAG...... 1 828 427 401 F 30641 tctatttggagctcttcgga
GTTTTACAGAATCGTACTCGGCCTTGTTCG...... 2 705 388 317 F 3272 aattactggagttttacaga
GTATAATGATTCATCAACAAACAAAAGACA...... 3 692 383 309 R 30486 cccttttggagtataatgat
GCGTAATTCCACCTTTTTCTTCCCAATCTT...... 4 673 352 321 F 52555 tcttgttggagcgtaattcc
GGTATACATCATTAAATAACGATGTATATC...... 5 641 333 308 F 163251 agaaattggaggtatacatc
GTATTTCAAGAAACGTGATAAAGCCCAGGC...... 6 577 318 259 F 121764 aacgtttggagtatttcaag
GCGTAATTGCTTCAGGTAAGCCTTTAGGAT...... 7 505 256 249 F 73140 agaatatggagcgtaattgc
GTGCATGATTGGTAACAGTTCGGCAACCCA...... 8 505 277 228 F 40411 ggtctttggagtgcatgatt
GTTTTACAGACAACGCAAATCTTATCTGAC...... 9 496 253 243 F 115803 atcgattggagttttacaga
GCTGAAAAGGCAGCTGAAACTAAAGCCGCT...... 10 494 270 224 R 3702 taaattagcagctgaaaagg
GTATAATGTAAAAACAAACCTGAGGAAATT...... 11 490 274 216 R 32654 ctcccttggagtataatgta
GTATTAACAAGATTCCAGAATTTCTCACCC...... 12 481 253 228 R 75276 gttttctggagtattaacaa
GTTTCTCAGCGATTTTAATCGACCACTCTT...... 13 448 238 210 F 29924 tcgtcttggagtttctcagc
GTTACATAAGCATCAGGAGCAGATGGTCCC...... 14 445 254 191 R 102003 ttgctttggagttacataag
GCTTTAATCTTAACAATAGTGCCGAGATAA...... 15 443 245 198 F 165136 gtatttacctgctttaatct
GCTGAACGTACCGAAGTTGCAGGTATGACT...... 16 440 266 174 R 28799 gttgttcagagctgaacgta
GTATAATCTTTCTATCAACTTGAGGAGAAT...... 17 434 217 217 R 46215 gatggatggagtataatctt
GCTGCATCTTCAGATTGGTCTTCGTCTTCA...... 18 431 251 180 F 5448 ttcagatggagctgcatctt
GTTATTACTAAACAAGTTTTTAACCGCACT...... 19 426 222 204 R 122567 ctcccttggagttattacta
GTTAACAAATGCCATACGACATTTAAGGGA...... 20 425 208 217 F 56968 aacgtttagagttaacaaat
  1. 1 Orientation in genome. F, forward; R, reverse.
  2. 2 Position in genome.
  3. 3 The genomic sequence around the start site of the HFSs.