Skip to main content

Table 1 Synthetic oligonucleotides used for amplification of the FMDV genomea

From: Isolation, identification and complete genome sequence analysis of a strain of foot-and-mouth disease virus serotype Asia1 from pigs in southwest of China

Primers Position Sequence(5'-3') Fragment
S1 b Used for 5'-RACE CATGGCTACATGCTGACAGCCTA 5'RACE
S2 344-367 TGAAAGGCGGGCGCTTGGTGACA 5'RACE
U1 379-399 TAAgTTTTACCGTCGTTCCC UFR
U2 718-736 ACCGAGCGTGGAGTCAAT UFR
A1 524-541 CGGAAGTAAAACGGCACA A
A2 2276-2293 GATTTCCAACAGCGGTCA A
B1 2217-2233 CGTGTTTGGCAGCCTCAT B
B2 4700-4717 CCACGGGTTCAGGTCTCG B
C1 4576-4593 AACGGCCCAAGCAAGTAT C
C2 6599-6616 TGGAAACGCACGAGCAGT C
D1 6205-6222 GGCAGAGCCATGACAGAC D
D2 7458-7475 GGGTGGAAGCCAAACTCT D
GSP1 7446-7463 GGTGTTTCGCACAGAGTT 3'RACE
R1 3'end TAAgCAAgCATgCCATATgTT 3'RACE
3' RACERTc Used for 3'-RACE TAAgCAAgCATgCCATATg(T)15  
  1. a The primers used in this study were designed based on JS/CHA/05 (Accession NO. EF149009)
  2. b S1 was used in 5'-RACE for amplification of the 5' end of RNA.
  3. c 3'RACERT was used in 3'-RACE for amplification of the 3' end of RNA.