Skip to main content

Table 1 Primers used to amplify the proviral genomic DNA of SCDY1

From: Sequence analysis for the complete proviral genome of subgroup J Avian Leukosis virus associated with hemangioma: a special 11 bp deletion was observed in U3 region of 3'UTR

No. Name Sequence(5'----3') Position corresponding to the genome of HPRS-103 Expected size(bp)
1 A1F GGCTCTTATGTAACGATG 16-33 614
  A1R GGAAATCACCTTTATGACGG 610-629  
2 A2F GATGTGATAGTTAGGGAATAGTGG 336-359 1160
  A2R CTCTCATTAGATTCGTAACGTC 1474-1495  
3 A3F TCACAAGACTGGCTGATACGGT 1376-1397 1098
  A3R CCGAAATAATAGTGATGTCCGC 2452-2473  
4 A4F TCATTCTGACTAACACTGGGAG 2378-2399 1191
  A4R CGCAACTGCTCATAAAAGGG 3548-3568  
5 A5F GTAGCAGAACCCAGGATAGC 3447-3466 1376
  A5R GTGAAGCAGGACCCATTATC 4803-4822  
6 A6F CGTGTCACATCGGTTGCTG 4725-4743 745
  A6R CCCTGGGACAACGGAAATA 5451-5469  
7 A7F ACTCTAAGAAGAAGCCGCC 5342-5360 1921
  A7R CGA TTCGCAAGT TTCATACC 7243-7262  
8 A8F GTTTGCCTTGCTTGTCATAG 6855-6874 968
  A8R CAGGTGCTCGTAGTTGTCA 7804-782  
9* A9F TTAGGAAGGCAACAGACGG 7644-7662 466
  A9R GGGCGACCAGAATCACG 574-591  
  1. * Primers used to amplify the long terminal repeat (LTR) sequences from circularized viral DNA of SCDY1.