Skip to main content

Table 2 Primers used in the this study

From: Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1

Primer name Primer sequences (5' to 3') Note
P15f ATAGGATCC ATGTTCGGGGCAACTTTCG UL15 forward/Bam HIa
P15r GGCAAGCTT TGGTACATATCCTACGTGCGC UL15 reverse/Hin dIIIa
Psjf TTGAATTATTCCAGAAGATGA Splice junction forward
Psjr TTTCTTGCATAAATGAATCG Splice junction reverse
P898f AATTTGGGCAACTCAATGGTT Northern probe forward
P898r TCTGCCGTACGTCTCATAGC Northern probe reverse
P15-5 TGGTGCATGCTCGCAACAGT UL15 5'-RACE primer
P15.5-5 TGTTCCAACCCGTATATTAC UL15.5'-RACE primer
P15-3 TTACCACTGCGTGCCTCCCA UL15 3'-RACE primer
Paf GCGCTCGTTGTTGACA β-actin forward
Par TCATCCCAGTTGGTGACA β-actin reverse
  1. aThe incorporated Bam HI and Hin dIII enzyme sites within P15f and P15r are underlined within primer sequences respectively.