Skip to main content

Table 1 Sequences of primers and target siRNAs

From: Role of HCV Core gene of genotype 1a and 3a and host gene Cox-2 in HCV-induced pathogenesis

Primers used in vector construction
Core3a-sense ATGAGCACACTTCCTAAACC
Core3a-antisense CATGGCTGCTGGATGAATTA
3aCore-sense GCGATATCATGAGCACACTTCCTAAA
3aCore-antisense AATCTAGATCATGGCTGCTGGATGAAT
1aCore-sense GCGATATCAGCACGAATCCTAAAGGT
1aCore-antisense AATCTAGATTAGG CTGAAGCGGGCACGGT
Primers used in Real-Time PCR
RTp3.1-sense GGACGACGATGACAAGGACT
RT1a-antisense GGGGAGACAGGA GCCATC
RT3a-antisense GGCTGTGACCGTTCAGAAGT
Cox-2-sense AACCCACTCCAAACACAG
Cox-2-antisense CTGGCCCTCGCTTATGATCT
iNOS-sense CACCTTGGAGTTCACCCAGT
iNOS-antisense ACCA CTCGTACTTGGGATGC
VEGF-sense CTTGCCTTGCTGCTCTACC
VEGF-antisense CACACAGGATGGCTTGAAG
GAPDH-sense ACCACAGTCCATGCCATCAC
GAPDH-antisense TCCACCACCCTGTTGCTGTA
siRNAs used for silencing
Csi27-sense AAGGATGGTGTTTCTTTTGGTCCTGTCTC
Csi27-antisense AAACCAAAAGAAACACCATCCCCTGTCTC
Csi352-sense AAATCGATGACTTTACCCAAACCTGTCTC
Csi352-antisense AATTTGGGTAAAGTCATCGATCCTGTCTC
Scramble-sense AAGTCGAGTCGCGTATGCAGGCCTGTCTC
Scramble-antisense AACCTGCATACGCGACTCGACCCTGTCTC
COXsi-sense AATTATTTCTGAAACCCACTCCCTGTCTC
COXsi-antisense AAGAGTGGGTTTCAGAAATAACCTGTCTC