Skip to main content

Table 4 Details of oligo nucleotides used in PCR reactions

From: Rapid detection of anti-Vaccinia virus neutralizing antibodies

Oligo name Oligonucleotide sequence 5'→3' S/A Ta (°C) Tm (°C)
c-myc    60.0  
c-myc F GCCAGAGGAGGAACGAGCT S   59.4
c-myc R GGGCCTTTTCATTGTTTTCCA A   54.2
c-myc TM F-TGCCCTGCGTGACCAGATCC-T S   65.9
OPV 12/13 /MPXV
82 protein
   62.0  
OPV F GCCAATTGTCTTTCTCTTTTACTGA S   56.2
OPV R GAAAACATTTAAGGATGAATCCATCT A   55.4
OPV TMGB F-CCTTCTATAGATCTGAGAAT NQF MGB S   65.5
rpo18/polymerase #    60.0  
rpo18 F CTGTAGTTATAAACGTTCCGTGTG S   50.7
rpo 18 R TTATCATACGCATTACCATTTCGA A   47.0
rpo18 TM F-ATCGCTAAATGATACAGTACCCGAAXTCTCTACT-PH    
D8L/IMV membrane protein    60.0  
D8L F GGATGTTCTATATACGGGGATGAGTAG S   57.9
D8L R AAAGTTAATAAGGTAGATGACACGTTCT A   58.5
D8L TM F-TTCTCATCATCAGAATAAA-NFQ MGB S   65.1
  1. Y = C or T, B = C or G or T, W = A or T, F = FAM label, T = TAMRA label, TM = hydrolysis probe, TMGB = hydrolysis probe coupled to an MGB moiety; MGB = Minor Groove Binder, NFQ = Non-fluorescent quencher, Tm = Melting temperature (calculated by nearest neighbor method), Ta = Annealing temperature, A = antisense orientation, S = sense orientation, # [7].