Skip to main content

Table 1 Primers used for amplification of virus sequences for the production of hairpin RNAi constructs.

From: Selection of target sequences as well as sequence identity determine the outcome of RNAi approach for resistance against cotton leaf curl geminivirus complex

Construct Primer Sequence* Cloning sites in sense orientation Cloning sites in antisense orientation
CLCRNAiRepC4/pFGC AC1-4 SF
AC1-4 SR
AC1-4 ASF
AC1-4 ASR
GTTCCATGG CCCAAACTTCAAGTTCTTC
CAGGGCGCGCC CATCAGTTGTCTCCAAT
CAAGGATCC CCCCAAACGTTTTAAAGTAC
TTCTCTAGA ACTTGATCGAAAGAAGAAGG
Asc I+Nco I Bam HI+Xba I
CLCRNAiRepTrAPREn/pFGC AC123 SF
AC123 SR
AC123 ASF
AC123 ASR
CCCCTCGAG GCTACGTTGAAGATTAGGAT
TTCGGCGCGCC TCCTGGTCCCAACAGCAGT
TTCTCTAGA AATCCTGGTCCCAACAGCAGT
CCCCCCGGG GCTACGTTGAAGATTAGGAT
Xho I+Asc I Xba I+Sma I
CLCRNAiIR/pFGC IR SF
IR SR
IR ASF
IR ASR
TGACTCGAG TCAATTGGAGACAACTGAT
GTTCCATGG TGAAACTTAGTGCGCAAG
GTTGGATCC TGAAACTTAGTGCGCAAG
TGATCTAGA TCAATTGGAGACAACTGAT
Xho I+Nco I BamHI+Xba I
  1. * The restriction sites included in primers are underlined.