Skip to main content

Table 2 Oligonucleotide primers and probes used in this work

From: Detection of myxoma viruses encoding a defective M135R gene from clinical cases of myxomatosis; possible implications for the role of the M135R protein as a virulence factor

Primers Sequence (5'-3')
myxE3Lfor TAACAACCGCCGTAAATGTG
myxE3Lrev GCAAACCAAAAATCCGTGTAC
MyxM029Lfor GTTGGTAATTTCATTTCGTACCA
MyxM029Lrev GGTAAACAATTAATCCGTTGTAA
M135Rfor CCATACAGAAAGAGATTCAGTTGGA
M135Rrev GGAGTCTGTATACAGTGATAAATCCTT
M135RXFOR CCCTCGAGATAAACATGGTGTTTATATTTATTATC
M135RAPAREV TTGGGCCC TTACAGGACGCCTAAGGATATC
CATBamfor TAGGATCCGGGATGGAGAAAAAAATCACTGG
CATXSrev CCGTCGAC TTA CTCGAGCGCCCCGCCCTGCCACTC
M138Lfor TTAGGAAGATGTCCAGGAATC
M139Rrev CCGTATTTGTTCGGCAGACC
M153Rfor GTGTATAGACTGTCGTACCTAC
M154Rrev ACGGCAATCAACTTCCCGAC
M009Lfor CAACTGGGATTTCTGCGTAC
M009Lrev GACGTAATGCGTCGGCGTG
M036Lfor CAACAGAACGGCAACAATTTATGT
M036Lrev ACGTGCAGTAACGCCTGTTC
M148Rfor CGACCATCTGATAATGTATGTC
M148Rrev ACAGGGATCGAGAGTGAACG
Probe  
SwinemyxE3LCOMP 6FAM-CTCAACGAATATTGTCAGATTA-MGBNFQ
  1. Added restriction enzyme sites within the primer sequences are underlined and nucleotides corresponding to the initiation and termination codons within the M135R and CAT sequences are indicated by bold italics.