Skip to main content

Advertisement

Table 2 Oligonucleotidesa used for cloning procedures

From: Human Coronavirus NL63 Open Reading Frame 3 encodes a virion-incorporated N-glycosylated membrane protein

Primer Sequence (5'-end to 3'-end) +/- NC_005831b
pcDNA3.1/NT-GFP-TOPO
5'NL63-E-GFP TTCCTTCGATTAATTGATGAC + 25203-25223
5'NL63-M-GFP TCTAATAGTAGTGTGCCTC + 25445-25463
5'NL63-N-GFP GCTAGTGTAAATTGGGCC + 26136-26153
5'NL63-O3-GFP CCTTTTGGTGGCCTATTTC + 24545-24563
3'NL63-EpK R TTAGACATTTAGTACTTCAGCTGG - 25410-25433
3'NL63-MpK R TTAGATTAAATGAAGCAACTTCTC - 26099-26122
3'NL63-NpK R TTAATGCAAAACCTCGTTGAC - 27246-27266
3'NL63-O3 ACAAGGAGCCATAAAATG - 25244-25261
pcDNA3.1/V5-His-TOPO
5'Leader-NL GACTTTGTGTCTACTCTTC + 45 - 63
3'NL63-O3s ATTAATCGAAGGAACATC - 25199-25216
NL63-O3mis-Asn16 F CTTACTCTTGAAAGTACTATTCAGAAGAGTGTGGCTAATCTC + 25567-25609
NL63-O3mis-Asn16 R GAGATTAGCCACACTCTTCTGAATAGTACTTTCAAGAGTAAG - 25567-25609
pCAGGSc
5'Eco-FLAG_O3-63 GCAGCAGAATTC ATGGACTACAAGGACGACGATGACAAG CCTTTTGGTGGCCTATTTCAACTTAC + 24544-24570
3'Not-O3-63 CCTCCTGCGGCCGC TCAATTAATCGAAGGAACATCTTCGTATAG - 25190-25219
5'Eco-HA-E GCAGCAGAATTC ATGTACCCATACGATGTTCCAGATTACGCT TTCCTTCGATTAATTGATGACAATG + 25203-25227
3'Not-E CCTCCTGCGGCCGC TTAGACATTTAGTACTTCAGCTG - 25411-25433
5'Eco-HA-M GCAGCAGAATTC ATGTACCCATACGATGTTCCAGATTACGCT TCTAATAGTAGTGTGCCTCTTTTAGAG + 25446-25472
3'Not-M CCTCCTGCGGCCGC TTAGATTAAATGAAGCAACTTCTCTC - 26098-26123
5'Eco-HA-N GCAGCAGAATTC ATGTACCCATACGATGTTCCAGATTACGCT GCTAGTGTAAATTGGGCCGATGACAG + 26138-26163
3'Not-N CCTCCTGCGGCCGC TTAATGCAAAACCTCGTTGACAATTTC - 27242-27268
  1. aOligonucleotides were provided by TIBMolbiol, Berlin, Germany
  2. bAccession no. hCoV-NL63 strain Amsterdam I
  3. cUnderlined are additional nucleotides representing restriction sites and a FLAG or HA-tag (italics)